ID: 1193498542_1193498548

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1193498542 1193498548
Species Human (GRCh38) Human (GRCh38)
Location X:82241914-82241936 X:82241951-82241973
Sequence CCTTTTTTCCCCAGTTTTGGGTA GGATGAAAACAGACTAATACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!