ID: 1193607676_1193607688

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1193607676 1193607688
Species Human (GRCh38) Human (GRCh38)
Location X:83588563-83588585 X:83588613-83588635
Sequence CCAAACTCCATCTCATTCTGCTG CTGTCAGTGGGTTCCTCTCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!