ID: 1193609647_1193609649

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1193609647 1193609649
Species Human (GRCh38) Human (GRCh38)
Location X:83614006-83614028 X:83614039-83614061
Sequence CCCTAAGATGACTATAGTTAACA TTTTCAAATAACTAGAAGAGAGG
Strand - +
Off-target summary {0: 3, 1: 8, 2: 35, 3: 76, 4: 275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!