ID: 1193715122_1193715136

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1193715122 1193715136
Species Human (GRCh38) Human (GRCh38)
Location X:84928009-84928031 X:84928056-84928078
Sequence CCACCCCTCCCTCTAGGAGCACT TGTCAGCTGCAGGATATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 93, 4: 498} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!