ID: 1193715144_1193715150

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1193715144 1193715150
Species Human (GRCh38) Human (GRCh38)
Location X:84928093-84928115 X:84928113-84928135
Sequence CCCATTTGGGAGGTCCTGCCCAG CAGTGAAGAAGAATGGAATCAGG
Strand - +
Off-target summary {0: 5, 1: 10, 2: 86, 3: 133, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!