ID: 1193715145_1193715153

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1193715145 1193715153
Species Human (GRCh38) Human (GRCh38)
Location X:84928094-84928116 X:84928145-84928167
Sequence CCATTTGGGAGGTCCTGCCCAGT AAAGAAGTCTGGCCATGTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 26, 3: 82, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!