ID: 1193723514_1193723520

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1193723514 1193723520
Species Human (GRCh38) Human (GRCh38)
Location X:85015650-85015672 X:85015681-85015703
Sequence CCTCCGCCTCCCGGGTGTAAGTG GCCTCAGCCTCCCGAGTACCTGG
Strand - +
Off-target summary {0: 4, 1: 117, 2: 5642, 3: 38167, 4: 102971} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!