ID: 1193760779_1193760783

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1193760779 1193760783
Species Human (GRCh38) Human (GRCh38)
Location X:85462822-85462844 X:85462839-85462861
Sequence CCACTGTCCTATCTGACTGAAGT TGAAGTGCACTTGGGCCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!