ID: 1193847041_1193847049

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1193847041 1193847049
Species Human (GRCh38) Human (GRCh38)
Location X:86485359-86485381 X:86485412-86485434
Sequence CCAGAGAATGGGGAGGGCAGGCT GTACAAACCTACAGTTAGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 14, 2: 65, 3: 275, 4: 876}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!