ID: 1193897007_1193897013

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1193897007 1193897013
Species Human (GRCh38) Human (GRCh38)
Location X:87127075-87127097 X:87127089-87127111
Sequence CCAGCACATCCCCAGGTATGGTA GGTATGGTAACAATAGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 283} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!