ID: 1193897015_1193897019

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1193897015 1193897019
Species Human (GRCh38) Human (GRCh38)
Location X:87127114-87127136 X:87127129-87127151
Sequence CCTTCTGCTTGAGAAAAGGAGAG AAGGAGAGGAAATAGTAAAGGGG
Strand - +
Off-target summary {0: 27, 1: 240, 2: 502, 3: 638, 4: 899} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!