ID: 1193898823_1193898830

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1193898823 1193898830
Species Human (GRCh38) Human (GRCh38)
Location X:87149864-87149886 X:87149916-87149938
Sequence CCAAGTAATAAGCACAGTACTTT CCCAGCTTCCACCTTCATGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 99, 4: 613} {0: 1, 1: 1, 2: 11, 3: 181, 4: 949}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!