ID: 1193903869_1193903873

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1193903869 1193903873
Species Human (GRCh38) Human (GRCh38)
Location X:87218986-87219008 X:87219016-87219038
Sequence CCCAAGTATCTTTTTTCCCAGAT TTAAATGTAAGATCAGCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 358} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!