ID: 1193947367_1193947371

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1193947367 1193947371
Species Human (GRCh38) Human (GRCh38)
Location X:87755074-87755096 X:87755089-87755111
Sequence CCCAAACATTGCAGAGTTAACAG GTTAACAGTACCAAGGTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 7, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!