ID: 1194001094_1194001096

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1194001094 1194001096
Species Human (GRCh38) Human (GRCh38)
Location X:88429429-88429451 X:88429450-88429472
Sequence CCATCAATATCCTCATTGATGCT CTACAGCTTCTCTTAAACTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!