ID: 1194013814_1194013820

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1194013814 1194013820
Species Human (GRCh38) Human (GRCh38)
Location X:88594734-88594756 X:88594758-88594780
Sequence CCAGTTAACTAAGCTTTGACAAA TTGGAAAAATAAATGGGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 52, 4: 600}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!