ID: 1194042033_1194042039

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1194042033 1194042039
Species Human (GRCh38) Human (GRCh38)
Location X:88952859-88952881 X:88952901-88952923
Sequence CCCAACCTTGCTCACTTCCTCTC ATGTTCTGCTTCAAAAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 535} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!