ID: 1194215348_1194215357

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1194215348 1194215357
Species Human (GRCh38) Human (GRCh38)
Location X:91124175-91124197 X:91124224-91124246
Sequence CCTGTTACACCCCAGGGCCAAGT AATCCTGCCCCTGTACCCCTTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 7, 3: 25, 4: 144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!