ID: 1194250187_1194250191

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1194250187 1194250191
Species Human (GRCh38) Human (GRCh38)
Location X:91564727-91564749 X:91564768-91564790
Sequence CCAAGTGCCATCTGTGCTTATGA GACATTTCCATGATTATCATCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!