ID: 1194380863_1194380867

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1194380863 1194380867
Species Human (GRCh38) Human (GRCh38)
Location X:93190509-93190531 X:93190529-93190551
Sequence CCAGGAAAGCTAAGAGAACCCAC CACAGACCCTTTGAAGGAACTGG
Strand - +
Off-target summary No data {0: 47, 1: 97, 2: 297, 3: 298, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!