ID: 1194388921_1194388929

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1194388921 1194388929
Species Human (GRCh38) Human (GRCh38)
Location X:93292418-93292440 X:93292458-93292480
Sequence CCATCCAGCCATCCAACACAGAG GAGGGAGAATGCAGTGACTGGGG
Strand - +
Off-target summary No data {0: 4, 1: 18, 2: 58, 3: 171, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!