ID: 1194400618_1194400622

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1194400618 1194400622
Species Human (GRCh38) Human (GRCh38)
Location X:93434926-93434948 X:93434953-93434975
Sequence CCAAAACGGTGACCCAGCGGTGT CCTGCCGACAGCATAATGCGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 26, 3: 24, 4: 46} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!