ID: 1194532478_1194532485

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1194532478 1194532485
Species Human (GRCh38) Human (GRCh38)
Location X:95068715-95068737 X:95068755-95068777
Sequence CCACAGCAGTGTAGGACATTGGT CTTTCCAGGCACTAGCTCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 25, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!