ID: 1194604241_1194604247

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1194604241 1194604247
Species Human (GRCh38) Human (GRCh38)
Location X:95960873-95960895 X:95960896-95960918
Sequence CCAGGTAGCTGGCTGATCACCCC GAGGAACGTTGCCATATTGAGGG
Strand - +
Off-target summary {0: 88, 1: 205, 2: 207, 3: 161, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!