ID: 1194606518_1194606522

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1194606518 1194606522
Species Human (GRCh38) Human (GRCh38)
Location X:95985570-95985592 X:95985598-95985620
Sequence CCTCACTCAGTGTCCAGAGAGGC GCACCATGAGGCTGCTGCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 17, 3: 89, 4: 833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!