ID: 1194665003_1194665005

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1194665003 1194665005
Species Human (GRCh38) Human (GRCh38)
Location X:96667712-96667734 X:96667734-96667756
Sequence CCAGGCATCAGCAGGGTTGGTTT TCTTCTGAGGCCTCTCTCATTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 37, 4: 234} {0: 5, 1: 195, 2: 621, 3: 1140, 4: 1473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!