ID: 1194665003_1194665007

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1194665003 1194665007
Species Human (GRCh38) Human (GRCh38)
Location X:96667712-96667734 X:96667747-96667769
Sequence CCAGGCATCAGCAGGGTTGGTTT CTCTCATTGGCTTGCAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 37, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!