ID: 1194716474_1194716477

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1194716474 1194716477
Species Human (GRCh38) Human (GRCh38)
Location X:97291873-97291895 X:97291910-97291932
Sequence CCTTCAACTATCTGGTTGTCAGG TTATCCTTAGTTTACAGATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 116, 3: 826, 4: 3216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!