ID: 1194756431_1194756441

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1194756431 1194756441
Species Human (GRCh38) Human (GRCh38)
Location X:97744153-97744175 X:97744171-97744193
Sequence CCCATAATCCCCATGTGTCATGG CATGGGAGGGACACTGTGGAAGG
Strand - +
Off-target summary {0: 418, 1: 1219, 2: 2434, 3: 3877, 4: 4839} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!