ID: 1194756433_1194756441

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1194756433 1194756441
Species Human (GRCh38) Human (GRCh38)
Location X:97744154-97744176 X:97744171-97744193
Sequence CCATAATCCCCATGTGTCATGGG CATGGGAGGGACACTGTGGAAGG
Strand - +
Off-target summary {0: 402, 1: 1210, 2: 2456, 3: 3865, 4: 4759} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!