ID: 1194777890_1194777894

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1194777890 1194777894
Species Human (GRCh38) Human (GRCh38)
Location X:97988136-97988158 X:97988183-97988205
Sequence CCTTTAGCTTAGATCTCATAATG AGCTGACTCACAGTCACTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!