ID: 1194931963_1194931968

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1194931963 1194931968
Species Human (GRCh38) Human (GRCh38)
Location X:99900003-99900025 X:99900021-99900043
Sequence CCCTCCAGGTCCTGCTTAAAGGT AAGGTCCATAAATACCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211} {0: 1, 1: 22, 2: 33, 3: 49, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!