ID: 1194944180_1194944190

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1194944180 1194944190
Species Human (GRCh38) Human (GRCh38)
Location X:100048575-100048597 X:100048613-100048635
Sequence CCCCCAAGCCTTGGTGGCTTCCA GCAGGTGAACAGAAGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 18, 3: 49, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!