ID: 1195017517_1195017522

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1195017517 1195017522
Species Human (GRCh38) Human (GRCh38)
Location X:100793906-100793928 X:100793925-100793947
Sequence CCCTGAAACAGCCCTATATTCCC TCCCTGTAAAGAAACTAAGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!