ID: 1195057932_1195057934

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1195057932 1195057934
Species Human (GRCh38) Human (GRCh38)
Location X:101164631-101164653 X:101164646-101164668
Sequence CCAAAGTACCTGTTTTTATGGAG TTATGGAGTTTACATTCCAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 184} {0: 2, 1: 4, 2: 38, 3: 225, 4: 923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!