ID: 1195068752_1195068765

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1195068752 1195068765
Species Human (GRCh38) Human (GRCh38)
Location X:101260184-101260206 X:101260226-101260248
Sequence CCTTTCCCAGCCCCTTTCTCCAT TTTCCTGCCCAAGGCTTTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 169, 4: 1145} {0: 1, 1: 0, 2: 0, 3: 20, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!