ID: 1195068752_1195068772

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1195068752 1195068772
Species Human (GRCh38) Human (GRCh38)
Location X:101260184-101260206 X:101260237-101260259
Sequence CCTTTCCCAGCCCCTTTCTCCAT AGGCTTTGCGGGGCTGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 169, 4: 1145} {0: 1, 1: 0, 2: 3, 3: 21, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!