ID: 1195098790_1195098794

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1195098790 1195098794
Species Human (GRCh38) Human (GRCh38)
Location X:101532932-101532954 X:101532964-101532986
Sequence CCTGCCTCCCTGTTGGGAGAATA GAATAGATGCTGAATGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 140} {0: 1, 1: 0, 2: 1, 3: 21, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!