ID: 1195107151_1195107156

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1195107151 1195107156
Species Human (GRCh38) Human (GRCh38)
Location X:101613640-101613662 X:101613659-101613681
Sequence CCTTCTGACAGCTCTTAGGAACC AACCCTTAGGAACCGGGACAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!