ID: 1195107690_1195107698

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1195107690 1195107698
Species Human (GRCh38) Human (GRCh38)
Location X:101616661-101616683 X:101616691-101616713
Sequence CCTTGCTCCACCTGATTGAAGAG AGGTCCAGGGTGAGTAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113} {0: 1, 1: 0, 2: 1, 3: 22, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!