ID: 1195148695_1195148706

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1195148695 1195148706
Species Human (GRCh38) Human (GRCh38)
Location X:102043864-102043886 X:102043908-102043930
Sequence CCACCCCCCACCAGAGCTATTAA CCCTGGACACAGCTCCCACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 44, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!