ID: 1195176357_1195176363

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1195176357 1195176363
Species Human (GRCh38) Human (GRCh38)
Location X:102318581-102318603 X:102318616-102318638
Sequence CCAGGTAAGGCTGACAGCAGCAA CGGGGGCAGAGAGGTCTGCCTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 15, 4: 143} {0: 3, 1: 0, 2: 1, 3: 28, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!