ID: 1195186985_1195186990 |
View in Genome Browser |
Spacer: 13 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1195186985 | 1195186990 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:102410072-102410094 | X:102410108-102410130 |
| Sequence | CCAAGTGGGATTTATCCCTGGGT | CTACATACACACATCAATCAAGG |
| Strand | - | + |
| Off-target summary | {0: 3, 1: 147, 2: 436, 3: 861, 4: 1290} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||