ID: 1195215161_1195215167

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1195215161 1195215167
Species Human (GRCh38) Human (GRCh38)
Location X:102691910-102691932 X:102691959-102691981
Sequence CCTGGTGAGATGCACCCGTTACC TCTTCTGCGTCGCTCACGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 78, 3: 2463, 4: 2762} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!