ID: 1195269552_1195269564

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1195269552 1195269564
Species Human (GRCh38) Human (GRCh38)
Location X:103215880-103215902 X:103215926-103215948
Sequence CCACACGCCATCCTCGTCCTCCA AGATGGATCTACAGGGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 333} {0: 1, 1: 1, 2: 3, 3: 24, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!