ID: 1195285887_1195285892

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1195285887 1195285892
Species Human (GRCh38) Human (GRCh38)
Location X:103383303-103383325 X:103383316-103383338
Sequence CCCACCCACTTCTCCCAGTTCTG CCCAGTTCTGCACTCTCCACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!