ID: 1195300339_1195300344

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1195300339 1195300344
Species Human (GRCh38) Human (GRCh38)
Location X:103524160-103524182 X:103524197-103524219
Sequence CCAGCAATCACTGTGCTTTCTTA CAGGAACCATCTTAGGCACTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 32, 4: 290} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!