ID: 1195322013_1195322020

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1195322013 1195322020
Species Human (GRCh38) Human (GRCh38)
Location X:103728132-103728154 X:103728153-103728175
Sequence CCTGAGGAGGACCTGCCCTGGCA CAGGGTCCAGAGAAGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 267} {0: 1, 1: 0, 2: 8, 3: 61, 4: 592}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!