ID: 1195332850_1195332860

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1195332850 1195332860
Species Human (GRCh38) Human (GRCh38)
Location X:103819923-103819945 X:103819946-103819968
Sequence CCTAACCCCCCAAGGTTATGGCA TTATAAGGAGATGGGGCCTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!