ID: 1195406341_1195406347

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1195406341 1195406347
Species Human (GRCh38) Human (GRCh38)
Location X:104518230-104518252 X:104518280-104518302
Sequence CCAGTAAAACCATTTAGGCCTGG TTTTTTTTTTTTTTTTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 53, 3: 157, 4: 553} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!